data_34533 ####################### # Entry information # ####################### save_entry_information _Saveframe_category entry_information _Entry_title ; Structure of a parallel c-myc modified with 5' duplex stem-loop and 3' diagonal snap-back loop ; _BMRB_accession_number 34533 _BMRB_flat_file_name bmr34533.str _Entry_type original _Submission_date 2020-07-20 _Accession_date 2020-07-20 _Entry_origination author _NMR_STAR_version 2.1.1 _Experimental_method NMR _Details . loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Vianney Y. M. . 2 Weisz K. . . stop_ loop_ _Saveframe_category_type _Saveframe_category_type_count assigned_chemical_shifts 1 stop_ loop_ _Data_type _Data_type_count "1H chemical shifts" 242 stop_ loop_ _Revision_date _Revision_keyword _Revision_author _Revision_detail 2020-10-01 original BMRB . stop_ _Original_release_date 2020-07-27 save_ ############################# # Citation for this entry # ############################# save_citation_1 _Saveframe_category entry_citation _Citation_full . _Citation_title ; Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands ; _Citation_status published _Citation_type journal _CAS_abstract_code . _MEDLINE_UI_code . _PubMed_ID 32975874 loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Vianney Y. M. . 2 Preckwinkel P. . . 3 Mohr S. . . 4 Weisz K. . . stop_ _Journal_abbreviation Chemistry _Journal_volume . _Journal_issue . _Journal_CSD 0353 _Book_chapter_title . _Book_volume . _Book_series . _Book_ISBN . _Conference_state_province . _Conference_abstract_number . _Page_first . _Page_last . _Year 2020 _Details . save_ ################################## # Molecular system description # ################################## save_assembly _Saveframe_category molecular_system _Mol_system_name 'DNA (36-MER)' _Enzyme_commission_number . loop_ _Mol_system_component_name _Mol_label unit_1 $entity_1 stop_ _System_molecular_weight . _System_oligomer_state ? _System_paramagnetic no _System_thiol_state . _Database_query_date . _Details . save_ ######################## # Monomeric polymers # ######################## save_entity_1 _Saveframe_category monomeric_polymer _Mol_type polymer _Mol_polymer_class DNA _Name_common entity_1 _Molecular_mass 11340.253 _Mol_thiol_state 'not present' _Details . ############################## # Polymer residue sequence # ############################## _Residue_count 36 _Mol_residue_sequence ; GATCAGTTTTACTGATCGGG TGGTGGGTGGGGAAGG ; loop_ _Residue_seq_code _Residue_label 1 DG 2 DA 3 DT 4 DC 5 DA 6 DG 7 DT 8 DT 9 DT 10 DT 11 DA 12 DC 13 DT 14 DG 15 DA 16 DT 17 DC 18 DG 19 DG 20 DG 21 DT 22 DG 23 DG 24 DT 25 DG 26 DG 27 DG 28 DT 29 DG 30 DG 31 DG 32 DG 33 DA 34 DA 35 DG 36 DG stop_ _Sequence_homology_query_date . _Sequence_homology_query_revised_last_date . save_ #################### # Natural source # #################### save_natural_source _Saveframe_category natural_source loop_ _Mol_label _Organism_name_common _NCBI_taxonomy_ID _Superkingdom _Kingdom _Genus _Species $entity_1 . 32630 . . . . stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Saveframe_category experimental_source loop_ _Mol_label _Production_method _Host_organism_name_common _Genus _Species _Strain _Vector_name $entity_1 'chemical synthesis' . . . . . stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Saveframe_category sample _Sample_type solution _Details '0.62 mM 0 nucleic acid, 90% H2O/10% D2O' loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 0.62 mM 'natural abundance' stop_ save_ save_sample_2 _Saveframe_category sample _Sample_type solution _Details '0.25 mM 0 nucleic acid, 90% H2O/10% D2O' loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 0.25 mM 'natural abundance' stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Saveframe_category software _Name 'CcpNmr Analysis' _Version 2.4.2 loop_ _Vendor _Address _Electronic_address CCPN . . stop_ loop_ _Task 'chemical shift assignment' 'data analysis' 'peak picking' stop_ _Details . save_ save_software_2 _Saveframe_category software _Name 'X-PLOR NIH' _Version 2.52 loop_ _Vendor _Address _Electronic_address 'Schwieters, Kuszewski, Tjandra and Clore' . . stop_ loop_ _Task 'structure calculation' stop_ _Details . save_ save_software_3 _Saveframe_category software _Name TopSpin _Version 4.0.7 loop_ _Vendor _Address _Electronic_address 'Bruker Biospin' . . stop_ loop_ _Task processing stop_ _Details . save_ save_software_4 _Saveframe_category software _Name Amber _Version 16 loop_ _Vendor _Address _Electronic_address 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . stop_ loop_ _Task refinement stop_ _Details . save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model 'AVANCE NEO' _Field_strength 600 _Details . save_ ############################# # NMR applied experiments # ############################# save_2D_1H-13C_HSQC_aromatic_1 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-13C HSQC aromatic' _Sample_label $sample_2 save_ save_2D_1H-1H_NOESY_2 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-1H NOESY' _Sample_label $sample_1 save_ save_2D_DQF-COSY_3 _Saveframe_category NMR_applied_experiment _Experiment_name '2D DQF-COSY' _Sample_label $sample_2 save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Saveframe_category sample_conditions _Details . loop_ _Variable_type _Variable_value _Variable_value_error _Variable_value_units 'ionic strength' 10 . mM pH 7.0 . pH pressure 1 . atm temperature 293 . K stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Saveframe_category chemical_shift_reference _Details . loop_ _Mol_common_name _Atom_type _Atom_isotope_number _Atom_group _Chem_shift_units _Chem_shift_value _Reference_method _Reference_type _External_reference_sample_geometry _External_reference_location _External_reference_axis _Indirect_shift_ratio water H 1 protons ppm 4.84 internal direct . . . 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Saveframe_category assigned_chemical_shifts _Details '2D 1H-1H NOESY = 300ms and 80 ms mixing time' loop_ _Experiment_label '2D 1H-13C HSQC aromatic' '2D 1H-1H NOESY' '2D DQF-COSY' stop_ loop_ _Sample_label $sample_2 $sample_1 stop_ _Sample_conditions_label $sample_conditions_1 _Chem_shift_reference_set_label $chem_shift_reference_1 _Mol_system_component_name unit_1 _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 1 1 DG H1 H 11.941 . 1 2 1 1 DG H1' H 5.231 0.001 1 3 1 1 DG H2' H 1.891 0.001 1 4 1 1 DG H2'' H 2.233 0.001 1 5 1 1 DG H3' H 4.489 0.003 1 6 1 1 DG H8 H 7.082 0.002 1 7 2 2 DA H1' H 6.057 0.003 1 8 2 2 DA H2 H 7.572 0.0 1 9 2 2 DA H2' H 2.502 0.002 1 10 2 2 DA H2'' H 2.806 0.003 1 11 2 2 DA H3' H 4.781 0.005 1 12 2 2 DA H8 H 8.019 0.0 1 13 3 3 DT H1' H 5.836 0.003 1 14 3 3 DT H2' H 1.951 0.006 1 15 3 3 DT H2'' H 2.361 0.002 1 16 3 3 DT H3 H 13.365 0.002 1 17 3 3 DT H3' H 4.793 . 1 18 3 3 DT H6 H 7.038 0.001 1 19 3 3 DT H71 H 1.157 0.001 1 20 3 3 DT H72 H 1.157 0.001 1 21 3 3 DT H73 H 1.157 0.001 1 22 4 4 DC H1' H 5.422 0.002 1 23 4 4 DC H2' H 1.945 . 1 24 4 4 DC H2'' H 2.289 0.001 1 25 4 4 DC H3' H 4.081 0.006 1 26 4 4 DC H5 H 5.521 0.002 1 27 4 4 DC H6 H 7.403 0.001 1 28 4 4 DC H41 H 6.627 0.001 1 29 4 4 DC H42 H 8.319 0.001 1 30 5 5 DA H1' H 5.984 0.001 1 31 5 5 DA H2 H 7.514 . 1 32 5 5 DA H2' H 2.734 0.003 1 33 5 5 DA H2'' H 2.822 0.002 1 34 5 5 DA H3' H 5.000 0.001 1 35 5 5 DA H8 H 8.160 0.001 1 36 6 6 DG H1 H 12.781 0.002 1 37 6 6 DG H1' H 5.770 0.0 1 38 6 6 DG H2' H 2.389 0.001 1 39 6 6 DG H2'' H 2.558 0.002 1 40 6 6 DG H3' H 4.782 0.003 1 41 6 6 DG H8 H 7.529 0.002 1 42 7 7 DT H1' H 6.026 0.001 1 43 7 7 DT H2' H 1.965 0.003 1 44 7 7 DT H2'' H 2.091 0.001 1 45 7 7 DT H3' H 4.277 0.003 1 46 7 7 DT H6 H 7.202 0.001 1 47 7 7 DT H71 H 1.300 0.004 1 48 7 7 DT H72 H 1.300 0.004 1 49 7 7 DT H73 H 1.300 0.004 1 50 8 8 DT H1' H 6.285 0.001 1 51 8 8 DT H2' H 1.945 0.003 1 52 8 8 DT H2'' H 2.322 0.002 1 53 8 8 DT H3' H 4.750 0.002 1 54 8 8 DT H6 H 7.767 0.001 1 55 8 8 DT H71 H 1.902 0.003 1 56 8 8 DT H72 H 1.902 0.003 1 57 8 8 DT H73 H 1.902 0.003 1 58 9 9 DT H1' H 5.523 0.002 1 59 9 9 DT H2' H 1.838 0.001 1 60 9 9 DT H2'' H 2.103 0.0 1 61 9 9 DT H3' H 4.524 0.001 1 62 9 9 DT H6 H 7.489 0.001 1 63 9 9 DT H71 H 1.625 0.002 1 64 9 9 DT H72 H 1.625 0.002 1 65 9 9 DT H73 H 1.625 0.002 1 66 10 10 DT H1' H 5.943 0.001 1 67 10 10 DT H2' H 2.090 0.001 1 68 10 10 DT H2'' H 2.300 0.0 1 69 10 10 DT H3' H 4.637 . 1 70 10 10 DT H6 H 7.352 0.001 1 71 10 10 DT H71 H 1.665 0.0 1 72 10 10 DT H72 H 1.665 0.0 1 73 10 10 DT H73 H 1.665 0.0 1 74 11 11 DA H1' H 6.365 0.002 1 75 11 11 DA H2' H 2.758 0.001 1 76 11 11 DA H2'' H 2.976 0.002 1 77 11 11 DA H3' H 4.878 0.001 1 78 11 11 DA H8 H 8.349 0.001 1 79 12 12 DC H1' H 6.093 0.001 1 80 12 12 DC H2' H 1.845 0.002 1 81 12 12 DC H2'' H 2.565 0.0 1 82 12 12 DC H3' H 4.686 0.001 1 83 12 12 DC H5 H 5.167 0.001 1 84 12 12 DC H6 H 7.263 0.001 1 85 12 12 DC H41 H 7.976 0.004 1 86 12 12 DC H42 H 6.563 0.001 1 87 13 13 DT H1' H 5.812 0.001 1 88 13 13 DT H2' H 1.819 0.002 1 89 13 13 DT H2'' H 2.272 0.001 1 90 13 13 DT H3 H 13.717 0.001 1 91 13 13 DT H3' H 4.797 0.0 1 92 13 13 DT H6 H 7.148 0.001 1 93 13 13 DT H71 H 1.458 0.003 1 94 13 13 DT H72 H 1.458 0.003 1 95 13 13 DT H73 H 1.458 0.003 1 96 14 14 DG H1 H 12.387 0.002 1 97 14 14 DG H1' H 5.468 0.0 1 98 14 14 DG H2' H 2.681 0.001 1 99 14 14 DG H2'' H 2.681 0.001 1 100 14 14 DG H3' H 4.955 0.003 1 101 14 14 DG H8 H 7.846 0.001 1 102 15 15 DA H1' H 6.171 0.001 1 103 15 15 DA H2 H 7.616 0.0 1 104 15 15 DA H2' H 2.548 0.001 1 105 15 15 DA H2'' H 2.855 0.0 1 106 15 15 DA H3' H 4.913 0.0 1 107 15 15 DA H8 H 8.104 0.001 1 108 16 16 DT H1' H 5.833 0.002 1 109 16 16 DT H2' H 1.956 0.002 1 110 16 16 DT H2'' H 2.386 0.002 1 111 16 16 DT H3 H 13.805 0.002 1 112 16 16 DT H3' H 4.781 0.002 1 113 16 16 DT H6 H 7.027 0.001 1 114 16 16 DT H71 H 1.215 0.002 1 115 16 16 DT H72 H 1.215 0.002 1 116 16 16 DT H73 H 1.215 0.002 1 117 17 17 DC H1' H 5.843 0.003 1 118 17 17 DC H2' H 2.227 0.003 1 119 17 17 DC H2'' H 2.376 0.003 1 120 17 17 DC H3' H 4.840 0.003 1 121 17 17 DC H5 H 5.115 0.001 1 122 17 17 DC H6 H 7.302 0.001 1 123 17 17 DC H41 H 6.164 0.002 1 124 17 17 DC H42 H 7.953 . 1 125 18 18 DG H1 H 11.487 0.001 1 126 18 18 DG H1' H 6.093 0.004 1 127 18 18 DG H2' H 2.652 0.001 1 128 18 18 DG H2'' H 2.924 0.001 1 129 18 18 DG H3' H 4.921 0.003 1 130 18 18 DG H8 H 7.881 0.001 1 131 19 19 DG H1 H 11.346 0.004 1 132 19 19 DG H1' H 6.162 0.001 1 133 19 19 DG H2' H 2.541 . 1 134 19 19 DG H2'' H 2.900 . 1 135 19 19 DG H3' H 5.002 . 1 136 19 19 DG H8 H 7.552 0.001 1 137 20 20 DG H1 H 10.961 0.002 1 138 20 20 DG H1' H 6.415 0.002 1 139 20 20 DG H2' H 2.887 . 1 140 20 20 DG H2'' H 2.739 0.003 1 141 20 20 DG H3' H 5.190 . 1 142 20 20 DG H8 H 7.662 0.001 1 143 21 21 DT H1' H 6.498 0.003 1 144 21 21 DT H2' H 2.498 . 1 145 21 21 DT H2'' H 2.680 . 1 146 21 21 DT H3' H 5.071 . 1 147 21 21 DT H6 H 7.842 0.0 1 148 21 21 DT H71 H 1.993 0.001 1 149 21 21 DT H72 H 1.993 0.001 1 150 21 21 DT H73 H 1.993 0.001 1 151 22 22 DG H1 H 11.695 0.004 1 152 22 22 DG H1' H 6.172 0.001 1 153 22 22 DG H2' H 2.288 0.003 1 154 22 22 DG H2'' H 2.846 0.001 1 155 22 22 DG H3' H 5.070 . 1 156 22 22 DG H8 H 7.892 0.002 1 157 23 23 DG H1 H 11.678 0.002 1 158 23 23 DG H1' H 6.127 0.0 1 159 23 23 DG H2' H 2.573 . 1 160 23 23 DG H2'' H 2.875 . 1 161 23 23 DG H3' H 5.136 . 1 162 23 23 DG H8 H 7.901 0.003 1 163 24 24 DT H1' H 6.485 . 1 164 24 24 DT H2' H 2.449 . 1 165 24 24 DT H2'' H 2.660 . 1 166 24 24 DT H3' H 5.110 . 1 167 24 24 DT H6 H 7.885 0.001 1 168 24 24 DT H71 H 1.991 . 1 169 24 24 DT H72 H 1.991 . 1 170 24 24 DT H73 H 1.991 . 1 171 25 25 DG H1 H 11.236 0.002 1 172 25 25 DG H1' H 6.117 0.003 1 173 25 25 DG H2' H 2.813 0.002 1 174 25 25 DG H2'' H 2.870 . 1 175 25 25 DG H3' H 4.895 0.002 1 176 25 25 DG H8 H 8.186 0.001 1 177 26 26 DG H1 H 11.234 0.001 1 178 26 26 DG H1' H 6.162 0.002 1 179 26 26 DG H2' H 2.545 0.0 1 180 26 26 DG H2'' H 2.891 0.0 1 181 26 26 DG H3' H 4.989 . 1 182 26 26 DG H8 H 7.669 0.001 1 183 27 27 DG H1 H 11.116 0.002 1 184 27 27 DG H1' H 6.274 . 1 185 27 27 DG H2' H 2.640 0.0 1 186 27 27 DG H2'' H 2.656 0.001 1 187 27 27 DG H3' H 5.147 . 1 188 27 27 DG H8 H 7.552 0.0 1 189 28 28 DT H1' H 6.480 0.003 1 190 28 28 DT H2' H 2.466 0.007 1 191 28 28 DT H2'' H 2.662 . 1 192 28 28 DT H3' H 5.031 . 1 193 28 28 DT H6 H 7.826 0.002 1 194 28 28 DT H71 H 1.985 0.002 1 195 28 28 DT H72 H 1.985 0.002 1 196 28 28 DT H73 H 1.985 0.002 1 197 29 29 DG H1 H 11.472 0.001 1 198 29 29 DG H1' H 5.841 . 1 199 29 29 DG H2' H 2.257 0.0 1 200 29 29 DG H2'' H 2.632 0.0 1 201 29 29 DG H3' H 5.018 . 1 202 29 29 DG H8 H 7.720 0.003 1 203 30 30 DG H1 H 11.361 0.002 1 204 30 30 DG H1' H 5.857 0.002 1 205 30 30 DG H2' H 2.533 0.001 1 206 30 30 DG H2'' H 2.633 0.001 1 207 30 30 DG H3' H 4.999 . 1 208 30 30 DG H8 H 7.731 0.001 1 209 31 31 DG H1 H 10.740 0.003 1 210 31 31 DG H1' H 5.861 0.002 1 211 31 31 DG H2' H 1.623 0.002 1 212 31 31 DG H2'' H 1.965 . 1 213 31 31 DG H3' H 4.996 . 1 214 31 31 DG H8 H 7.100 0.001 1 215 32 32 DG H1 H 10.715 0.003 1 216 32 32 DG H1' H 5.287 0.002 1 217 32 32 DG H2' H 2.765 0.002 1 218 32 32 DG H2'' H 2.600 0.004 1 219 32 32 DG H3' H 4.843 . 1 220 32 32 DG H8 H 7.891 0.001 1 221 33 33 DA H1' H 5.420 0.001 1 222 33 33 DA H2 H 7.187 0.0 1 223 33 33 DA H2' H 2.011 0.003 1 224 33 33 DA H2'' H 2.129 . 1 225 33 33 DA H8 H 7.869 0.001 1 226 34 34 DA H1' H 5.713 0.001 1 227 34 34 DA H2 H 7.401 0.001 1 228 34 34 DA H2' H 2.469 0.003 1 229 34 34 DA H2'' H 2.741 0.002 1 230 34 34 DA H3' H 4.519 0.003 1 231 34 34 DA H8 H 7.522 0.001 1 232 35 35 DG H1' H 5.563 0.001 1 233 35 35 DG H2' H 1.708 0.003 1 234 35 35 DG H2'' H 2.606 0.001 1 235 35 35 DG H3' H 4.612 0.004 1 236 35 35 DG H8 H 7.181 0.001 1 237 36 36 DG H1 H 11.564 0.001 1 238 36 36 DG H1' H 6.340 0.0 1 239 36 36 DG H2' H 2.612 0.005 1 240 36 36 DG H2'' H 3.336 0.003 1 241 36 36 DG H3' H 4.933 0.003 1 242 36 36 DG H8 H 7.686 0.001 1 stop_ save_