data_34533 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 34533 _Entry.Title ; Structure of a parallel c-myc modified with 5' duplex stem-loop and 3' diagonal snap-back loop ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2020-07-20 _Entry.Accession_date 2020-07-20 _Entry.Last_release_date 2020-07-27 _Entry.Original_release_date 2020-07-27 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Y. Vianney Y. M. . . 34533 2 K. Weisz K. . . . 34533 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID DNA . 34533 Duplex . 34533 G-quadruplex . 34533 'Quadruplex-Duplex Junction' . 34533 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 34533 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 242 34533 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2021-09-09 2020-07-20 update BMRB 'update entry citation' 34533 1 . . 2020-10-01 2020-07-20 original author 'original release' 34533 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 6ZTE 'BMRB Entry Tracking System' 34533 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 34533 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 32975874 _Citation.DOI 10.1002/chem.202003540 _Citation.Full_citation . _Citation.Title ; Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev Chemistry _Citation.Journal_name_full . _Citation.Journal_volume 26 _Citation.Journal_issue 70 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 16910 _Citation.Page_last 16922 _Citation.Year 2020 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Y. Vianney Y. M. . . 34533 1 2 P. Preckwinkel P. . . . 34533 1 3 S. Mohr S. . . . 34533 1 4 K. Weisz K. . . . 34533 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 34533 _Assembly.ID 1 _Assembly.Name 'DNA (36-MER)' _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 34533 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 34533 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GATCAGTTTTACTGATCGGG TGGTGGGTGGGGAAGG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 36 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 11340.253 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . DG . 34533 1 2 . DA . 34533 1 3 . DT . 34533 1 4 . DC . 34533 1 5 . DA . 34533 1 6 . DG . 34533 1 7 . DT . 34533 1 8 . DT . 34533 1 9 . DT . 34533 1 10 . DT . 34533 1 11 . DA . 34533 1 12 . DC . 34533 1 13 . DT . 34533 1 14 . DG . 34533 1 15 . DA . 34533 1 16 . DT . 34533 1 17 . DC . 34533 1 18 . DG . 34533 1 19 . DG . 34533 1 20 . DG . 34533 1 21 . DT . 34533 1 22 . DG . 34533 1 23 . DG . 34533 1 24 . DT . 34533 1 25 . DG . 34533 1 26 . DG . 34533 1 27 . DG . 34533 1 28 . DT . 34533 1 29 . DG . 34533 1 30 . DG . 34533 1 31 . DG . 34533 1 32 . DG . 34533 1 33 . DA . 34533 1 34 . DA . 34533 1 35 . DG . 34533 1 36 . DG . 34533 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DG 1 1 34533 1 . DA 2 2 34533 1 . DT 3 3 34533 1 . DC 4 4 34533 1 . DA 5 5 34533 1 . DG 6 6 34533 1 . DT 7 7 34533 1 . DT 8 8 34533 1 . DT 9 9 34533 1 . DT 10 10 34533 1 . DA 11 11 34533 1 . DC 12 12 34533 1 . DT 13 13 34533 1 . DG 14 14 34533 1 . DA 15 15 34533 1 . DT 16 16 34533 1 . DC 17 17 34533 1 . DG 18 18 34533 1 . DG 19 19 34533 1 . DG 20 20 34533 1 . DT 21 21 34533 1 . DG 22 22 34533 1 . DG 23 23 34533 1 . DT 24 24 34533 1 . DG 25 25 34533 1 . DG 26 26 34533 1 . DG 27 27 34533 1 . DT 28 28 34533 1 . DG 29 29 34533 1 . DG 30 30 34533 1 . DG 31 31 34533 1 . DG 32 32 34533 1 . DA 33 33 34533 1 . DA 34 34 34533 1 . DG 35 35 34533 1 . DG 36 36 34533 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 34533 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 32630 'no natural source' . 'synthetic construct' . . . . . . . . . . . . . . . . . . . . 34533 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 34533 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 34533 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 34533 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.62 mM 0 nucleic acid, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'nucleic acid' 'natural abundance' . . 1 $entity_1 . . 0.62 . . mM . . . . 34533 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 34533 _Sample.ID 2 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.25 mM 0 nucleic acid, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'nucleic acid' 'natural abundance' . . 1 $entity_1 . . 0.25 . . mM . . . . 34533 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 34533 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 34533 1 pH 7.0 . pH 34533 1 pressure 1 . atm 34533 1 temperature 293 . K 34533 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 34533 _Software.ID 1 _Software.Type . _Software.Name 'CcpNmr Analysis' _Software.Version 2.4.2 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID CCPN . . 34533 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 34533 1 'data analysis' . 34533 1 'peak picking' . 34533 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 34533 _Software.ID 2 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version 2.52 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 34533 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'structure calculation' . 34533 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 34533 _Software.ID 3 _Software.Type . _Software.Name TopSpin _Software.Version 4.0.7 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 34533 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 34533 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 34533 _Software.ID 4 _Software.Type . _Software.Name Amber _Software.Version 16 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 34533 4 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 34533 4 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 34533 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE NEO' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 34533 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker 'AVANCE NEO' . 600 . . . 34533 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 34533 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-13C HSQC aromatic' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34533 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34533 1 3 '2D DQF-COSY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34533 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 34533 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 water protons . . . . ppm 4.84 internal direct 1 . . . . . 34533 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 34533 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details '2D 1H-1H NOESY = 300ms and 80 ms mixing time' _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-13C HSQC aromatic' . . . 34533 1 2 '2D 1H-1H NOESY' . . . 34533 1 3 '2D DQF-COSY' . . . 34533 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DG H1 H 1 11.941 . . 1 . . 463 . A 1 DG H1 . 34533 1 2 . 1 . 1 1 1 DG H1' H 1 5.231 0.001 . 1 . . 261 . A 1 DG H1' . 34533 1 3 . 1 . 1 1 1 DG H2' H 1 1.891 0.001 . 1 . . 259 . A 1 DG H2' . 34533 1 4 . 1 . 1 1 1 DG H2'' H 1 2.233 0.001 . 1 . . 260 . A 1 DG H2'' . 34533 1 5 . 1 . 1 1 1 DG H3' H 1 4.489 0.003 . 1 . . 306 . A 1 DG H3' . 34533 1 6 . 1 . 1 1 1 DG H8 H 1 7.082 0.002 . 1 . . 258 . A 1 DG H8 . 34533 1 7 . 1 . 1 2 2 DA H1' H 1 6.057 0.003 . 1 . . 247 . A 2 DA H1' . 34533 1 8 . 1 . 1 2 2 DA H2 H 1 7.572 0.0 . 1 . . 409 . A 2 DA H2 . 34533 1 9 . 1 . 1 2 2 DA H2' H 1 2.502 0.002 . 1 . . 245 . A 2 DA H2' . 34533 1 10 . 1 . 1 2 2 DA H2'' H 1 2.806 0.003 . 1 . . 246 . A 2 DA H2'' . 34533 1 11 . 1 . 1 2 2 DA H3' H 1 4.781 0.005 . 1 . . 307 . A 2 DA H3' . 34533 1 12 . 1 . 1 2 2 DA H8 H 1 8.019 0.0 . 1 . . 244 . A 2 DA H8 . 34533 1 13 . 1 . 1 3 3 DT H1' H 1 5.836 0.003 . 1 . . 274 . A 3 DT H1' . 34533 1 14 . 1 . 1 3 3 DT H2' H 1 1.951 0.006 . 1 . . 298 . A 3 DT H2' . 34533 1 15 . 1 . 1 3 3 DT H2'' H 1 2.361 0.002 . 1 . . 293 . A 3 DT H2'' . 34533 1 16 . 1 . 1 3 3 DT H3 H 1 13.365 0.002 . 1 . . 356 . A 3 DT H3 . 34533 1 17 . 1 . 1 3 3 DT H3' H 1 4.793 . . 1 . . 425 . A 3 DT H3' . 34533 1 18 . 1 . 1 3 3 DT H6 H 1 7.038 0.001 . 1 . . 287 . A 3 DT H6 . 34533 1 19 . 1 . 1 3 3 DT H71 H 1 1.157 0.001 . 1 . . 288 . A 3 DT H71 . 34533 1 20 . 1 . 1 3 3 DT H72 H 1 1.157 0.001 . 1 . . 288 . A 3 DT H72 . 34533 1 21 . 1 . 1 3 3 DT H73 H 1 1.157 0.001 . 1 . . 288 . A 3 DT H73 . 34533 1 22 . 1 . 1 4 4 DC H1' H 1 5.422 0.002 . 1 . . 296 . A 4 DC H1' . 34533 1 23 . 1 . 1 4 4 DC H2' H 1 1.945 . . 1 . . 294 . A 4 DC H2' . 34533 1 24 . 1 . 1 4 4 DC H2'' H 1 2.289 0.001 . 1 . . 297 . A 4 DC H2'' . 34533 1 25 . 1 . 1 4 4 DC H3' H 1 4.081 0.006 . 1 . . 427 . A 4 DC H3' . 34533 1 26 . 1 . 1 4 4 DC H5 H 1 5.521 0.002 . 1 . . 295 . A 4 DC H5 . 34533 1 27 . 1 . 1 4 4 DC H6 H 1 7.403 0.001 . 1 . . 273 . A 4 DC H6 . 34533 1 28 . 1 . 1 4 4 DC H41 H 1 6.627 0.001 . 1 . . 310 . A 4 DC H41 . 34533 1 29 . 1 . 1 4 4 DC H42 H 1 8.319 0.001 . 1 . . 404 . A 4 DC H42 . 34533 1 30 . 1 . 1 5 5 DA H1' H 1 5.984 0.001 . 1 . . 234 . A 5 DA H1' . 34533 1 31 . 1 . 1 5 5 DA H2 H 1 7.514 . . 1 . . 431 . A 5 DA H2 . 34533 1 32 . 1 . 1 5 5 DA H2' H 1 2.734 0.003 . 1 . . 229 . A 5 DA H2' . 34533 1 33 . 1 . 1 5 5 DA H2'' H 1 2.822 0.002 . 1 . . 230 . A 5 DA H2'' . 34533 1 34 . 1 . 1 5 5 DA H3' H 1 5.000 0.001 . 1 . . 429 . A 5 DA H3' . 34533 1 35 . 1 . 1 5 5 DA H8 H 1 8.160 0.001 . 1 . . 228 . A 5 DA H8 . 34533 1 36 . 1 . 1 6 6 DG H1 H 1 12.781 0.002 . 1 . . 358 . A 6 DG H1 . 34533 1 37 . 1 . 1 6 6 DG H1' H 1 5.770 0.0 . 1 . . 279 . A 6 DG H1' . 34533 1 38 . 1 . 1 6 6 DG H2' H 1 2.389 0.001 . 1 . . 300 . A 6 DG H2' . 34533 1 39 . 1 . 1 6 6 DG H2'' H 1 2.558 0.002 . 1 . . 299 . A 6 DG H2'' . 34533 1 40 . 1 . 1 6 6 DG H3' H 1 4.782 0.003 . 1 . . 432 . A 6 DG H3' . 34533 1 41 . 1 . 1 6 6 DG H8 H 1 7.529 0.002 . 1 . . 280 . A 6 DG H8 . 34533 1 42 . 1 . 1 7 7 DT H1' H 1 6.026 0.001 . 1 . . 255 . A 7 DT H1' . 34533 1 43 . 1 . 1 7 7 DT H2' H 1 1.965 0.003 . 1 . . 302 . A 7 DT H2' . 34533 1 44 . 1 . 1 7 7 DT H2'' H 1 2.091 0.001 . 1 . . 301 . A 7 DT H2'' . 34533 1 45 . 1 . 1 7 7 DT H3' H 1 4.277 0.003 . 1 . . 437 . A 7 DT H3' . 34533 1 46 . 1 . 1 7 7 DT H6 H 1 7.202 0.001 . 1 . . 276 . A 7 DT H6 . 34533 1 47 . 1 . 1 7 7 DT H71 H 1 1.300 0.004 . 1 . . 291 . A 7 DT H71 . 34533 1 48 . 1 . 1 7 7 DT H72 H 1 1.300 0.004 . 1 . . 291 . A 7 DT H72 . 34533 1 49 . 1 . 1 7 7 DT H73 H 1 1.300 0.004 . 1 . . 291 . A 7 DT H73 . 34533 1 50 . 1 . 1 8 8 DT H1' H 1 6.285 0.001 . 1 . . 254 . A 8 DT H1' . 34533 1 51 . 1 . 1 8 8 DT H2' H 1 1.945 0.003 . 1 . . 257 . A 8 DT H2' . 34533 1 52 . 1 . 1 8 8 DT H2'' H 1 2.322 0.002 . 1 . . 256 . A 8 DT H2'' . 34533 1 53 . 1 . 1 8 8 DT H3' H 1 4.750 0.002 . 1 . . 438 . A 8 DT H3' . 34533 1 54 . 1 . 1 8 8 DT H6 H 1 7.767 0.001 . 1 . . 252 . A 8 DT H6 . 34533 1 55 . 1 . 1 8 8 DT H71 H 1 1.902 0.003 . 1 . . 253 . A 8 DT H71 . 34533 1 56 . 1 . 1 8 8 DT H72 H 1 1.902 0.003 . 1 . . 253 . A 8 DT H72 . 34533 1 57 . 1 . 1 8 8 DT H73 H 1 1.902 0.003 . 1 . . 253 . A 8 DT H73 . 34533 1 58 . 1 . 1 9 9 DT H1' H 1 5.523 0.002 . 1 . . 281 . A 9 DT H1' . 34533 1 59 . 1 . 1 9 9 DT H2' H 1 1.838 0.001 . 1 . . 249 . A 9 DT H2' . 34533 1 60 . 1 . 1 9 9 DT H2'' H 1 2.103 0.0 . 1 . . 250 . A 9 DT H2'' . 34533 1 61 . 1 . 1 9 9 DT H3' H 1 4.524 0.001 . 1 . . 439 . A 9 DT H3' . 34533 1 62 . 1 . 1 9 9 DT H6 H 1 7.489 0.001 . 1 . . 248 . A 9 DT H6 . 34533 1 63 . 1 . 1 9 9 DT H71 H 1 1.625 0.002 . 1 . . 251 . A 9 DT H71 . 34533 1 64 . 1 . 1 9 9 DT H72 H 1 1.625 0.002 . 1 . . 251 . A 9 DT H72 . 34533 1 65 . 1 . 1 9 9 DT H73 H 1 1.625 0.002 . 1 . . 251 . A 9 DT H73 . 34533 1 66 . 1 . 1 10 10 DT H1' H 1 5.943 0.001 . 1 . . 233 . A 10 DT H1' . 34533 1 67 . 1 . 1 10 10 DT H2' H 1 2.090 0.001 . 1 . . 304 . A 10 DT H2' . 34533 1 68 . 1 . 1 10 10 DT H2'' H 1 2.300 0.0 . 1 . . 305 . A 10 DT H2'' . 34533 1 69 . 1 . 1 10 10 DT H3' H 1 4.637 . . 1 . . 426 . A 10 DT H3' . 34533 1 70 . 1 . 1 10 10 DT H6 H 1 7.352 0.001 . 1 . . 272 . A 10 DT H6 . 34533 1 71 . 1 . 1 10 10 DT H71 H 1 1.665 0.0 . 1 . . 303 . A 10 DT H71 . 34533 1 72 . 1 . 1 10 10 DT H72 H 1 1.665 0.0 . 1 . . 303 . A 10 DT H72 . 34533 1 73 . 1 . 1 10 10 DT H73 H 1 1.665 0.0 . 1 . . 303 . A 10 DT H73 . 34533 1 74 . 1 . 1 11 11 DA H1' H 1 6.365 0.002 . 1 . . 232 . A 11 DA H1' . 34533 1 75 . 1 . 1 11 11 DA H2' H 1 2.758 0.001 . 1 . . 226 . A 11 DA H2' . 34533 1 76 . 1 . 1 11 11 DA H2'' H 1 2.976 0.002 . 1 . . 227 . A 11 DA H2'' . 34533 1 77 . 1 . 1 11 11 DA H3' H 1 4.878 0.001 . 1 . . 231 . A 11 DA H3' . 34533 1 78 . 1 . 1 11 11 DA H8 H 1 8.349 0.001 . 1 . . 225 . A 11 DA H8 . 34533 1 79 . 1 . 1 12 12 DC H1' H 1 6.093 0.001 . 1 . . 275 . A 12 DC H1' . 34533 1 80 . 1 . 1 12 12 DC H2' H 1 1.845 0.002 . 1 . . 282 . A 12 DC H2' . 34533 1 81 . 1 . 1 12 12 DC H2'' H 1 2.565 0.0 . 1 . . 283 . A 12 DC H2'' . 34533 1 82 . 1 . 1 12 12 DC H3' H 1 4.686 0.001 . 1 . . 443 . A 12 DC H3' . 34533 1 83 . 1 . 1 12 12 DC H5 H 1 5.167 0.001 . 1 . . 263 . A 12 DC H5 . 34533 1 84 . 1 . 1 12 12 DC H6 H 1 7.263 0.001 . 1 . . 262 . A 12 DC H6 . 34533 1 85 . 1 . 1 12 12 DC H41 H 1 7.976 0.004 . 1 . . 405 . A 12 DC H41 . 34533 1 86 . 1 . 1 12 12 DC H42 H 1 6.563 0.001 . 1 . . 308 . A 12 DC H42 . 34533 1 87 . 1 . 1 13 13 DT H1' H 1 5.812 0.001 . 1 . . 278 . A 13 DT H1' . 34533 1 88 . 1 . 1 13 13 DT H2' H 1 1.819 0.002 . 1 . . 312 . A 13 DT H2' . 34533 1 89 . 1 . 1 13 13 DT H2'' H 1 2.272 0.001 . 1 . . 311 . A 13 DT H2'' . 34533 1 90 . 1 . 1 13 13 DT H3 H 1 13.717 0.001 . 1 . . 360 . A 13 DT H3 . 34533 1 91 . 1 . 1 13 13 DT H3' H 1 4.797 0.0 . 1 . . 444 . A 13 DT H3' . 34533 1 92 . 1 . 1 13 13 DT H6 H 1 7.148 0.001 . 1 . . 277 . A 13 DT H6 . 34533 1 93 . 1 . 1 13 13 DT H71 H 1 1.458 0.003 . 1 . . 290 . A 13 DT H71 . 34533 1 94 . 1 . 1 13 13 DT H72 H 1 1.458 0.003 . 1 . . 290 . A 13 DT H72 . 34533 1 95 . 1 . 1 13 13 DT H73 H 1 1.458 0.003 . 1 . . 290 . A 13 DT H73 . 34533 1 96 . 1 . 1 14 14 DG H1 H 1 12.387 0.002 . 1 . . 357 . A 14 DG H1 . 34533 1 97 . 1 . 1 14 14 DG H1' H 1 5.468 0.0 . 1 . . 314 . A 14 DG H1' . 34533 1 98 . 1 . 1 14 14 DG H2' H 1 2.681 0.001 . 1 . . 316 . A 14 DG H2' . 34533 1 99 . 1 . 1 14 14 DG H2'' H 1 2.681 0.001 . 1 . . 317 . A 14 DG H2'' . 34533 1 100 . 1 . 1 14 14 DG H3' H 1 4.955 0.003 . 1 . . 446 . A 14 DG H3' . 34533 1 101 . 1 . 1 14 14 DG H8 H 1 7.846 0.001 . 1 . . 313 . A 14 DG H8 . 34533 1 102 . 1 . 1 15 15 DA H1' H 1 6.171 0.001 . 1 . . 241 . A 15 DA H1' . 34533 1 103 . 1 . 1 15 15 DA H2 H 1 7.616 0.0 . 1 . . 389 . A 15 DA H2 . 34533 1 104 . 1 . 1 15 15 DA H2' H 1 2.548 0.001 . 1 . . 242 . A 15 DA H2' . 34533 1 105 . 1 . 1 15 15 DA H2'' H 1 2.855 0.0 . 1 . . 243 . A 15 DA H2'' . 34533 1 106 . 1 . 1 15 15 DA H3' H 1 4.913 0.0 . 1 . . 447 . A 15 DA H3' . 34533 1 107 . 1 . 1 15 15 DA H8 H 1 8.104 0.001 . 1 . . 240 . A 15 DA H8 . 34533 1 108 . 1 . 1 16 16 DT H1' H 1 5.833 0.002 . 1 . . 292 . A 16 DT H1' . 34533 1 109 . 1 . 1 16 16 DT H2' H 1 1.956 0.002 . 1 . . 319 . A 16 DT H2' . 34533 1 110 . 1 . 1 16 16 DT H2'' H 1 2.386 0.002 . 1 . . 318 . A 16 DT H2'' . 34533 1 111 . 1 . 1 16 16 DT H3 H 1 13.805 0.002 . 1 . . 359 . A 16 DT H3 . 34533 1 112 . 1 . 1 16 16 DT H3' H 1 4.781 0.002 . 1 . . 449 . A 16 DT H3' . 34533 1 113 . 1 . 1 16 16 DT H6 H 1 7.027 0.001 . 1 . . 266 . A 16 DT H6 . 34533 1 114 . 1 . 1 16 16 DT H71 H 1 1.215 0.002 . 1 . . 289 . A 16 DT H71 . 34533 1 115 . 1 . 1 16 16 DT H72 H 1 1.215 0.002 . 1 . . 289 . A 16 DT H72 . 34533 1 116 . 1 . 1 16 16 DT H73 H 1 1.215 0.002 . 1 . . 289 . A 16 DT H73 . 34533 1 117 . 1 . 1 17 17 DC H1' H 1 5.843 0.003 . 1 . . 271 . A 17 DC H1' . 34533 1 118 . 1 . 1 17 17 DC H2' H 1 2.227 0.003 . 1 . . 269 . A 17 DC H2' . 34533 1 119 . 1 . 1 17 17 DC H2'' H 1 2.376 0.003 . 1 . . 270 . A 17 DC H2'' . 34533 1 120 . 1 . 1 17 17 DC H3' H 1 4.840 0.003 . 1 . . 452 . A 17 DC H3' . 34533 1 121 . 1 . 1 17 17 DC H5 H 1 5.115 0.001 . 1 . . 265 . A 17 DC H5 . 34533 1 122 . 1 . 1 17 17 DC H6 H 1 7.302 0.001 . 1 . . 264 . A 17 DC H6 . 34533 1 123 . 1 . 1 17 17 DC H41 H 1 6.164 0.002 . 1 . . 406 . A 17 DC H41 . 34533 1 124 . 1 . 1 17 17 DC H42 H 1 7.953 . . 1 . . 408 . A 17 DC H42 . 34533 1 125 . 1 . 1 18 18 DG H1 H 1 11.487 0.001 . 1 . . 413 . A 18 DG H1 . 34533 1 126 . 1 . 1 18 18 DG H1' H 1 6.093 0.004 . 1 . . 320 . A 18 DG H1' . 34533 1 127 . 1 . 1 18 18 DG H2' H 1 2.652 0.001 . 1 . . 327 . A 18 DG H2' . 34533 1 128 . 1 . 1 18 18 DG H2'' H 1 2.924 0.001 . 1 . . 326 . A 18 DG H2'' . 34533 1 129 . 1 . 1 18 18 DG H3' H 1 4.921 0.003 . 1 . . 433 . A 18 DG H3' . 34533 1 130 . 1 . 1 18 18 DG H8 H 1 7.881 0.001 . 1 . . 321 . A 18 DG H8 . 34533 1 131 . 1 . 1 19 19 DG H1 H 1 11.346 0.004 . 1 . . 416 . A 19 DG H1 . 34533 1 132 . 1 . 1 19 19 DG H1' H 1 6.162 0.001 . 1 . . 323 . A 19 DG H1' . 34533 1 133 . 1 . 1 19 19 DG H2' H 1 2.541 . . 1 . . 329 . A 19 DG H2' . 34533 1 134 . 1 . 1 19 19 DG H2'' H 1 2.900 . . 1 . . 328 . A 19 DG H2'' . 34533 1 135 . 1 . 1 19 19 DG H3' H 1 5.002 . . 1 . . 434 . A 19 DG H3' . 34533 1 136 . 1 . 1 19 19 DG H8 H 1 7.552 0.001 . 1 . . 322 . A 19 DG H8 . 34533 1 137 . 1 . 1 20 20 DG H1 H 1 10.961 0.002 . 1 . . 417 . A 20 DG H1 . 34533 1 138 . 1 . 1 20 20 DG H1' H 1 6.415 0.002 . 1 . . 325 . A 20 DG H1' . 34533 1 139 . 1 . 1 20 20 DG H2' H 1 2.887 . . 1 . . 332 . A 20 DG H2' . 34533 1 140 . 1 . 1 20 20 DG H2'' H 1 2.739 0.003 . 1 . . 331 . A 20 DG H2'' . 34533 1 141 . 1 . 1 20 20 DG H3' H 1 5.190 . . 1 . . 442 . A 20 DG H3' . 34533 1 142 . 1 . 1 20 20 DG H8 H 1 7.662 0.001 . 1 . . 324 . A 20 DG H8 . 34533 1 143 . 1 . 1 21 21 DT H1' H 1 6.498 0.003 . 1 . . 335 . A 21 DT H1' . 34533 1 144 . 1 . 1 21 21 DT H2' H 1 2.498 . . 1 . . 343 . A 21 DT H2' . 34533 1 145 . 1 . 1 21 21 DT H2'' H 1 2.680 . . 1 . . 345 . A 21 DT H2'' . 34533 1 146 . 1 . 1 21 21 DT H3' H 1 5.071 . . 1 . . 454 . A 21 DT H3' . 34533 1 147 . 1 . 1 21 21 DT H6 H 1 7.842 0.0 . 1 . . 333 . A 21 DT H6 . 34533 1 148 . 1 . 1 21 21 DT H71 H 1 1.993 0.001 . 1 . . 334 . A 21 DT H71 . 34533 1 149 . 1 . 1 21 21 DT H72 H 1 1.993 0.001 . 1 . . 334 . A 21 DT H72 . 34533 1 150 . 1 . 1 21 21 DT H73 H 1 1.993 0.001 . 1 . . 334 . A 21 DT H73 . 34533 1 151 . 1 . 1 22 22 DG H1 H 1 11.695 0.004 . 1 . . 412 . A 22 DG H1 . 34533 1 152 . 1 . 1 22 22 DG H1' H 1 6.172 0.001 . 1 . . 351 . A 22 DG H1' . 34533 1 153 . 1 . 1 22 22 DG H2' H 1 2.288 0.003 . 1 . . 354 . A 22 DG H2' . 34533 1 154 . 1 . 1 22 22 DG H2'' H 1 2.846 0.001 . 1 . . 355 . A 22 DG H2'' . 34533 1 155 . 1 . 1 22 22 DG H3' H 1 5.070 . . 1 . . 453 . A 22 DG H3' . 34533 1 156 . 1 . 1 22 22 DG H8 H 1 7.892 0.002 . 1 . . 350 . A 22 DG H8 . 34533 1 157 . 1 . 1 23 23 DG H1 H 1 11.678 0.002 . 1 . . 420 . A 23 DG H1 . 34533 1 158 . 1 . 1 23 23 DG H1' H 1 6.127 0.0 . 1 . . 353 . A 23 DG H1' . 34533 1 159 . 1 . 1 23 23 DG H2' H 1 2.573 . . 1 . . 362 . A 23 DG H2' . 34533 1 160 . 1 . 1 23 23 DG H2'' H 1 2.875 . . 1 . . 361 . A 23 DG H2'' . 34533 1 161 . 1 . 1 23 23 DG H3' H 1 5.136 . . 1 . . 441 . A 23 DG H3' . 34533 1 162 . 1 . 1 23 23 DG H8 H 1 7.901 0.003 . 1 . . 352 . A 23 DG H8 . 34533 1 163 . 1 . 1 24 24 DT H1' H 1 6.485 . . 1 . . 340 . A 24 DT H1' . 34533 1 164 . 1 . 1 24 24 DT H2' H 1 2.449 . . 1 . . 342 . A 24 DT H2' . 34533 1 165 . 1 . 1 24 24 DT H2'' H 1 2.660 . . 1 . . 348 . A 24 DT H2'' . 34533 1 166 . 1 . 1 24 24 DT H3' H 1 5.110 . . 1 . . 458 . A 24 DT H3' . 34533 1 167 . 1 . 1 24 24 DT H6 H 1 7.885 0.001 . 1 . . 339 . A 24 DT H6 . 34533 1 168 . 1 . 1 24 24 DT H71 H 1 1.991 . . 1 . . 341 . A 24 DT H71 . 34533 1 169 . 1 . 1 24 24 DT H72 H 1 1.991 . . 1 . . 341 . A 24 DT H72 . 34533 1 170 . 1 . 1 24 24 DT H73 H 1 1.991 . . 1 . . 341 . A 24 DT H73 . 34533 1 171 . 1 . 1 25 25 DG H1 H 1 11.236 0.002 . 1 . . 419 . A 25 DG H1 . 34533 1 172 . 1 . 1 25 25 DG H1' H 1 6.117 0.003 . 1 . . 236 . A 25 DG H1' . 34533 1 173 . 1 . 1 25 25 DG H2' H 1 2.813 0.002 . 1 . . 238 . A 25 DG H2' . 34533 1 174 . 1 . 1 25 25 DG H2'' H 1 2.870 . . 1 . . 239 . A 25 DG H2'' . 34533 1 175 . 1 . 1 25 25 DG H3' H 1 4.895 0.002 . 1 . . 428 . A 25 DG H3' . 34533 1 176 . 1 . 1 25 25 DG H8 H 1 8.186 0.001 . 1 . . 235 . A 25 DG H8 . 34533 1 177 . 1 . 1 26 26 DG H1 H 1 11.234 0.001 . 1 . . 418 . A 26 DG H1 . 34533 1 178 . 1 . 1 26 26 DG H1' H 1 6.162 0.002 . 1 . . 366 . A 26 DG H1' . 34533 1 179 . 1 . 1 26 26 DG H2' H 1 2.545 0.0 . 1 . . 367 . A 26 DG H2' . 34533 1 180 . 1 . 1 26 26 DG H2'' H 1 2.891 0.0 . 1 . . 368 . A 26 DG H2'' . 34533 1 181 . 1 . 1 26 26 DG H3' H 1 4.989 . . 1 . . 457 . A 26 DG H3' . 34533 1 182 . 1 . 1 26 26 DG H8 H 1 7.669 0.001 . 1 . . 363 . A 26 DG H8 . 34533 1 183 . 1 . 1 27 27 DG H1 H 1 11.116 0.002 . 1 . . 422 . A 27 DG H1 . 34533 1 184 . 1 . 1 27 27 DG H1' H 1 6.274 . . 1 . . 365 . A 27 DG H1' . 34533 1 185 . 1 . 1 27 27 DG H2' H 1 2.640 0.0 . 1 . . 369 . A 27 DG H2' . 34533 1 186 . 1 . 1 27 27 DG H2'' H 1 2.656 0.001 . 1 . . 370 . A 27 DG H2'' . 34533 1 187 . 1 . 1 27 27 DG H3' H 1 5.147 . . 1 . . 268 . A 27 DG H3' . 34533 1 188 . 1 . 1 27 27 DG H8 H 1 7.552 0.0 . 1 . . 267 . A 27 DG H8 . 34533 1 189 . 1 . 1 28 28 DT H1' H 1 6.480 0.003 . 1 . . 338 . A 28 DT H1' . 34533 1 190 . 1 . 1 28 28 DT H2' H 1 2.466 0.007 . 1 . . 344 . A 28 DT H2' . 34533 1 191 . 1 . 1 28 28 DT H2'' H 1 2.662 . . 1 . . 346 . A 28 DT H2'' . 34533 1 192 . 1 . 1 28 28 DT H3' H 1 5.031 . . 1 . . 455 . A 28 DT H3' . 34533 1 193 . 1 . 1 28 28 DT H6 H 1 7.826 0.002 . 1 . . 336 . A 28 DT H6 . 34533 1 194 . 1 . 1 28 28 DT H71 H 1 1.985 0.002 . 1 . . 337 . A 28 DT H71 . 34533 1 195 . 1 . 1 28 28 DT H72 H 1 1.985 0.002 . 1 . . 337 . A 28 DT H72 . 34533 1 196 . 1 . 1 28 28 DT H73 H 1 1.985 0.002 . 1 . . 337 . A 28 DT H73 . 34533 1 197 . 1 . 1 29 29 DG H1 H 1 11.472 0.001 . 1 . . 414 . A 29 DG H1 . 34533 1 198 . 1 . 1 29 29 DG H1' H 1 5.841 . . 1 . . 372 . A 29 DG H1' . 34533 1 199 . 1 . 1 29 29 DG H2' H 1 2.257 0.0 . 1 . . 379 . A 29 DG H2' . 34533 1 200 . 1 . 1 29 29 DG H2'' H 1 2.632 0.0 . 1 . . 380 . A 29 DG H2'' . 34533 1 201 . 1 . 1 29 29 DG H3' H 1 5.018 . . 1 . . 459 . A 29 DG H3' . 34533 1 202 . 1 . 1 29 29 DG H8 H 1 7.720 0.003 . 1 . . 371 . A 29 DG H8 . 34533 1 203 . 1 . 1 30 30 DG H1 H 1 11.361 0.002 . 1 . . 415 . A 30 DG H1 . 34533 1 204 . 1 . 1 30 30 DG H1' H 1 5.857 0.002 . 1 . . 374 . A 30 DG H1' . 34533 1 205 . 1 . 1 30 30 DG H2' H 1 2.533 0.001 . 1 . . 378 . A 30 DG H2' . 34533 1 206 . 1 . 1 30 30 DG H2'' H 1 2.633 0.001 . 1 . . 377 . A 30 DG H2'' . 34533 1 207 . 1 . 1 30 30 DG H3' H 1 4.999 . . 1 . . 460 . A 30 DG H3' . 34533 1 208 . 1 . 1 30 30 DG H8 H 1 7.731 0.001 . 1 . . 373 . A 30 DG H8 . 34533 1 209 . 1 . 1 31 31 DG H1 H 1 10.740 0.003 . 1 . . 424 . A 31 DG H1 . 34533 1 210 . 1 . 1 31 31 DG H1' H 1 5.861 0.002 . 1 . . 376 . A 31 DG H1' . 34533 1 211 . 1 . 1 31 31 DG H2' H 1 1.623 0.002 . 1 . . 285 . A 31 DG H2' . 34533 1 212 . 1 . 1 31 31 DG H2'' H 1 1.965 . . 1 . . 286 . A 31 DG H2'' . 34533 1 213 . 1 . 1 31 31 DG H3' H 1 4.996 . . 1 . . 461 . A 31 DG H3' . 34533 1 214 . 1 . 1 31 31 DG H8 H 1 7.100 0.001 . 1 . . 284 . A 31 DG H8 . 34533 1 215 . 1 . 1 32 32 DG H1 H 1 10.715 0.003 . 1 . . 423 . A 32 DG H1 . 34533 1 216 . 1 . 1 32 32 DG H1' H 1 5.287 0.002 . 1 . . 385 . A 32 DG H1' . 34533 1 217 . 1 . 1 32 32 DG H2' H 1 2.765 0.002 . 1 . . 383 . A 32 DG H2' . 34533 1 218 . 1 . 1 32 32 DG H2'' H 1 2.600 0.004 . 1 . . 382 . A 32 DG H2'' . 34533 1 219 . 1 . 1 32 32 DG H3' H 1 4.843 . . 1 . . 563 . A 32 DG H3' . 34533 1 220 . 1 . 1 32 32 DG H8 H 1 7.891 0.001 . 1 . . 381 . A 32 DG H8 . 34533 1 221 . 1 . 1 33 33 DA H1' H 1 5.420 0.001 . 1 . . 386 . A 33 DA H1' . 34533 1 222 . 1 . 1 33 33 DA H2 H 1 7.187 0.0 . 1 . . 395 . A 33 DA H2 . 34533 1 223 . 1 . 1 33 33 DA H2' H 1 2.011 0.003 . 1 . . 388 . A 33 DA H2' . 34533 1 224 . 1 . 1 33 33 DA H2'' H 1 2.129 . . 1 . . 387 . A 33 DA H2'' . 34533 1 225 . 1 . 1 33 33 DA H8 H 1 7.869 0.001 . 1 . . 384 . A 33 DA H8 . 34533 1 226 . 1 . 1 34 34 DA H1' H 1 5.713 0.001 . 1 . . 391 . A 34 DA H1' . 34533 1 227 . 1 . 1 34 34 DA H2 H 1 7.401 0.001 . 1 . . 410 . A 34 DA H2 . 34533 1 228 . 1 . 1 34 34 DA H2' H 1 2.469 0.003 . 1 . . 393 . A 34 DA H2' . 34533 1 229 . 1 . 1 34 34 DA H2'' H 1 2.741 0.002 . 1 . . 392 . A 34 DA H2'' . 34533 1 230 . 1 . 1 34 34 DA H3' H 1 4.519 0.003 . 1 . . 436 . A 34 DA H3' . 34533 1 231 . 1 . 1 34 34 DA H8 H 1 7.522 0.001 . 1 . . 390 . A 34 DA H8 . 34533 1 232 . 1 . 1 35 35 DG H1' H 1 5.563 0.001 . 1 . . 397 . A 35 DG H1' . 34533 1 233 . 1 . 1 35 35 DG H2' H 1 1.708 0.003 . 1 . . 399 . A 35 DG H2' . 34533 1 234 . 1 . 1 35 35 DG H2'' H 1 2.606 0.001 . 1 . . 400 . A 35 DG H2'' . 34533 1 235 . 1 . 1 35 35 DG H3' H 1 4.612 0.004 . 1 . . 435 . A 35 DG H3' . 34533 1 236 . 1 . 1 35 35 DG H8 H 1 7.181 0.001 . 1 . . 396 . A 35 DG H8 . 34533 1 237 . 1 . 1 36 36 DG H1 H 1 11.564 0.001 . 1 . . 421 . A 36 DG H1 . 34533 1 238 . 1 . 1 36 36 DG H1' H 1 6.340 0.0 . 1 . . 398 . A 36 DG H1' . 34533 1 239 . 1 . 1 36 36 DG H2' H 1 2.612 0.005 . 1 . . 401 . A 36 DG H2' . 34533 1 240 . 1 . 1 36 36 DG H2'' H 1 3.336 0.003 . 1 . . 402 . A 36 DG H2'' . 34533 1 241 . 1 . 1 36 36 DG H3' H 1 4.933 0.003 . 1 . . 462 . A 36 DG H3' . 34533 1 242 . 1 . 1 36 36 DG H8 H 1 7.686 0.001 . 1 . . 394 . A 36 DG H8 . 34533 1 stop_ save_